عنصر Alu

از ویکی‌پدیا، دانشنامهٔ آزاد
پرش به: ناوبری، جستجو

عناصرAlu توالی‌های بسیار کوتاهی در دنا [۱] هستند؛ که به وسیله ی اندونوکلئازها جابه جا می‌شوند. در ژنوم نخستیان شکل‌های مختلفی از آن‌ها وجود دارد . در انسان بیش از صدها نمونه از آن‌ها وجود دارد که به راحتی از جایی به جای دیگر می‌روند. این عناصر توسط رنای سیتوپلاسمی کوچکی به نام ۷SL RNA، ساخته شده‌اند. رونوشتی از آن به عنصر Alu تبدیل شده و در نیای اولین نخستیان ساخته شده‌است.

این عناصر سبب بسیاری از بیماری‌ها و سرطان‌ها می‌باشند. همچنین مطالعه روی آن‌ها سبب گسترش دانش تکامل موجودات و از جمله انسان است .

خانواده ی Alu[ویرایش]

خانواده Alu تکرارهای نوکلئوتیدی در ژنوم انسان هستند . حدود ۳۰۰ جفت باز دارند و بنابر این در خانواده ی عناصر گسترش یافته ی کوتاه[۲] تقسیم می‌شوند . این خانواده ۱۰٫۷ در صد از ژنوم انسان را تشکل می‌دهند و کمتر از نیم درصد از آن‌ها چند شکل هستند . در سال ۱۹۹۸ این عناصر را در دو خانواده ی AluJ و AluS همچنین زیر خانواده‌هایی از آن‌ها تقسیم کردند .

۷SL RNA[ویرایش]

این رنا دارای ۲۹۹ نوکلئوتید است .

gccgggcgcggtggcgcgtgcctgtagtcccagctactcgggaggctgAGGCTGgaGGATCGcttgAGTCCAggAGTTCTgggct gtagtgcgctatgccgatcgggtgtccgcactaagttcggcatcaatatggtgacctcccgggagcgggggaccaccaggttgcctaagga ggggtgaaccggcccaggtcggaaacggagcaggtcaaaactcccgtgctgatcagtagtgggatcgcgcctgtgaatagccactgcactc cagcctgggcaacatagcgagaccccgtctct

توالی‌های شش تایی موجود در توالی کلی آن که با پیش برنده هم پوشانی دارد؛ توسط Aluاندونوکلئاز شناسایی شده و پیوند بین گوانین و سیتوزین برش می‌خورد .

عناصر Alu[ویرایش]

عناصر Alu رتروترانسپوزون‌هایی هستند؛ که به وسیله ی رنا پلیمراز III ساخته می‌شوند. هیچ پروتئینی از روی آن‌ها ساخته نمی‌شود. و از آن‌ها برای یافتن نیای مشترک استفاده می‌کنند . زیرا آن‌ها در طول زمان به ژنوم انسان افزوده شده‌اند و تغییرات زمانی بر روی آن‌ها مؤثر بوده‌است.

در نخستیان تعداد بسیار زیادی از آن‌ها وجود دارد؛ که تنها ۷۰۰۰ تای آن در ژنوم انسان دیده می‌شود.

عناصر Alu و بیماری زایی آن‌ها[ویرایش]

این عناصر با ایجاد تغییر در آلل‌ها ودگره‌ها [۳] وهمچنین افزوده‌شدنشان به برخی توالی‌ها در ایجاد سرطان و بسیاری دیگر از بیماری‌ها نقش دارند . در سال ۱۹۹۵ اولین گزارش‌ها حاکی از سرطان روده بود.

بیماری‌های ناشی از این عناصر[ویرایش]

  • سرطان سینه
  • هیپرکلسترومی خانوادگی
  • هموفیلی
  • دیابت نوع۲
  • نوروفیبروماتوز

تعدادی از بیماری در سطح رونویسی دچار اختلال می‌شوند[ویرایش]

پیوند به بیرون[ویرایش]


  1. این واژه مطابق با واژه‌های گردآوری شده ی فرهنگستان زبان و ادب فارسی برگردان دی‌ان‌ای است
  2. SINE
  3. این واژه مطابق با واژه‌های گردآوری شده ی فرهنگستان زبان و ادب فارسی برگردان آلل است


  • ویکی‌پدیاانگلیسی