روش تعیین توالی تفنگ ساچمه‌ای

از ویکی‌پدیا، دانشنامهٔ آزاد
پرش به: ناوبری، جستجو

در علم ژنتیک تعیین توالی تفنگ ساچمه‌ای روشی است که برای توالی یابی رشته‌های بلند DNA به کار می‌رود. اسم این روش از گسترش سریع و شبه تصادفی آن و تشابه‌اش به شلیک تفنگ ساچمه‌ای انتخاب شده است.

روش توالی‌یابی سنگر فقط برای برای رشته‌های به نسبت کوتاه ۱۰۰ تا ۱۰۰۰ جفت بازی قابل استفاده است. برای توالی‌یابی رشته‌های بلندتر آن‌ها را به رشته‌های کوتاه‌تر تقسیم می‌کنیم که می‌توان هر کدام را جداگانه توالی‌یابی کرد و سپس آن‌ها را مونتاژ می‌کنیم تا رشتهٔ اصلی به دست آید. یکی از روش‌های این کار روش تعیین توالی تفنگ ساچمه‌ای است.

در روش تعیین توالی تفنگ ساچمه‌ای[۱][۲] DNA را به صورت تصادفی به تعداد زیادی قسمت کوتاه می‌شکنیم و هر کدام به روش روش توالی‌یابی سنگر توالی‌یابی می‌کنیم با اجرای مکرر این روش تعدادی جواب برای رشتهٔ اصلی به دست می‌آید. سپس برنامه‌ای کامپیوتری با استفاده از مشترکات این جواب‌ها را مونتاژ می‌کند تا یک رشته به دست آید.[۱]

تعیین توالی تفنگ ساچمه‌ای یکی از فناوری‌های پیشرو ای است که امکان توالی‌یابی کلی ژنوم انسان را فراهم کردند.

مثال[ویرایش]

برای مثال این دو اجرای از توالی‌یابی تفنگ ساچمه‌ای را در نظر بگیرید:

رشته Sequence
اصلی AGCATGCTGCAGTCATGCTTAGGCTA
توالی‌یابی تفنگ ساچمه‌ای اول AGCATGCTGCAGTCATGCT----

----TAGGCTA

توالی‌یابی تفنگ ساچمه‌ای دوم AGCATG----

----CTGCAGTCATGCTTAGGCTA

بازسازی AGCATGCTGCAGTCATGCTTAGGCTA

در این مثال بسیار ساده هیچ‌کدام از جواب‌ها تمامی رشتهٰ‌ی اصلی را پوشش نمی‌دهند، اما با مونتاژ این ۴ جواب و با استفاده از ناحیه‌های مشترک آن‌ها می‌توانیم آن‌ها را مرتب کنیم و رشتهٔ اصلی را به دست آوریم، در واقعیت این فرایند با استفاده از مقدار عظیمی اطلاعات که مملو از ابهام و خطاهای توالی‌یابی هستند انجام می‌شود و همچنین مونتاژ ژنوم'های پیچیده بر این پیچیدگی می‌افزاید، برای مثال جواب‌های کوتاه یکسان می‌توانند از قسمت‌های کاملاً متفاوت رشتهٔ اصلی به دست آمده باشند.

برای حل این پیچیدگی‌ها به جواب‌های هم پوشان زیادی نیاز داریم تا بتوانیم مونتاژ را به دقت انجام دهیم. برای مثال در پروژهٔ ژنوم انسان اکثر ژنوم با ناحیهٔ پوشش ۱۲ (یا بیشتر) برابر توالی‌یابی شد. با این حال در سال ۲۰۰۴ این روش تقریباً در ۱٪ ژنوم انسان خطا کرد. [۳]

توالی‌یابی تفنگ ساچمه‌ای کل ژنوم[ویرایش]

تاریخچه[ویرایش]

اولین ژنوم توالی‌یابی شده توسط روش توالی‌یابی تفنگ ساچمه‌ای برای ویروس Cauliflower mosaic بود که در سال ۱۹۸۱ منتشر شد[۴][۵] در حالی که توالی‌یابی تفنگ ساچمه‌ای کل ژنوم برای ژنوم‌های کوتاه (۴۰۰۰ تا ۷۰۰۰ جفت‌باز) در سال ۱۹۷۹ پیشنهاد شده بود.[۱]

رویکرد[ویرایش]

در این روش یک مولکول سنگین دی‌ان‌ای به قسمت‌های تصادفی با اندازهٔ مشخص (معمولاً ۲، ۱۰، ۵۰، یا ۱۵۰ هزارتایی) تقسیم می‌شود و درون وکتور مناسب قرار می‌گیرند. سپس هر قسمت از هر دو طرف با استفاده از توالی‌یابی به روش سنگر توالی‌یابی می‌شوند و دو رشتهٔ کوتاه به دست می‌آید؛ و با توجه به اینکه توالی‌یابی به روش سنگر معمولاً جواب‌هایی با طول بین ۵۰۰ تا ۱۰۰۰ تولید می‌کند جواب‌ها (به غیر از جواب‌های خیلی کوتاه) به ندرت هم پوشانی خواهند داشت.

مونتاژ[ویرایش]

توالی اصلی با استفاده از جواب‌های به دست آمده و به وسیلهٔ نرم‌افزارهای بازسازی توالی ساخته می‌شود. ابتدا جواب‌هایی که هم‌پوشانی دارند به هم متصل می‌شوند و سپس با بررسی ارتباط آن‌ها رشتهٔ اصلی را به دست می‌آورند.

معایب و مزایا[ویرایش]

طرفداران این روش معتقدند که این روش امکان توالی‌یابی به یکبارهٔ کل ژنوم را با استفاده از آرایه‌ای بزرگ از توالی‌یاب‌ها را ایجاد می‌کند که بسیار کارآمد تر از روش‌های سنتی این کار است؛ و مخالفان استدلال می‌کنند که اگر چه این روش با سرعت بالایی قسمت‌های بزرگی از DNA را توالی‌یابی می‌کند اما در توانایی این روش برای مونتاژ صحیح این قسمت‌ها به خصوص در ژنوم‌های با تکرار زیاد شک وجوم دارد.

البته با توجه به این که برنامه‌های بازسازی توالی در حال قوی تر شدن هستند ممکن است این اشکال برطرف گردد.[نیازمند منبع]

پوشش[ویرایش]

پوشش برابر است با متوسط تعداد جواب‌هایی که در بازسازی توالی هر نوکلئوتید نقش دارند. با استفاده از طول ژنوم اصلی (G)، تعداد جواب‌ها (N) و متوسط طول جواب‌ها (L) می‌توان پوشش را به صورت محاسبه کرد. به عنوان مثال برای یک ژنوم فرضی با ۲۰۰۰ جفت بازسازی شده از ۸ جواب با میانگین ۵۰۰ نوکلئوتید پوشش برابر ۲ است. برای روش توالی‌یابی تفنگ ساچمه‌ای پوشش با مقدار زیاد مورد نظر است تا بتواند بر خطای مراحل تعیین نوکلئوتید و مونتاژ غلبه کند.

منابع[ویرایش]

  1. ۱٫۰ ۱٫۱ ۱٫۲ Staden, R (1979). "A strategy of DNA sequencing employing computer programs". Nucleic Acids Research 6 (7): 2601–10. PMC 327874. PMID 461197. doi:10.1093/nar/6.7.2601. 
  2. Anderson, S (1981). "Shotgun DNA sequencing using cloned DNase I-generated fragments". Nucleic Acids Research 9 (13): 3015–27. PMC 327328. PMID 6269069. doi:10.1093/nar/9.13.3015. 
  3. Human Genome Sequencing Consortium, International (21 October 2004). "Finishing the euchromatic sequence of the human genome". Nature 431 (7011): 931–945. PMID 15496913. doi:10.1038/nature03001. 
  4. Gardner, Richard C.; Howarth, Alan J.; Hahn, Peter; Brown-Luedi, Marianne; Shepherd, Robert J.; Messing, Joachim (1981-06-25). "The complete nucleotide sequence of an infectious clone of cauliflower mosaic virus by M13mp7 shotgun sequencing". Nucleic Acids Research (in English) 9 (12): 2871–2888. ISSN 0305-1048. PMC 326899. PMID 6269062. doi:10.1093/nar/9.12.2871. 
  5. Doctrow, Brian (2016-07-19). "Profile of Joachim Messing". Proceedings of the National Academy of Sciences (in English) 113 (29): 7935–7937. ISSN 0027-8424. PMID 27382176. doi:10.1073/pnas.1608857113.