حلقه‌های بنیادی

از ویکی‌پدیا، دانشنامهٔ آزاد
یک مثال از حلقه بنیادی در آران ای

ساختار حلقه-ساقه‌ای یا stem-loop الگویی است که می‌تواند در دی ان ای تک رشته‌ای و البته بیشتر در آر ان ای رخ دهد. این ساختار به عنوان سنجاق سر (hairpin) یا حلقه سنجاق سری (hairpin-loop) نیز شناخته می‌شود. ساختار ذکرشده زمانی به وجود می‌آید که دو ناحیه از یک رشته، که معمولاً وقتی آنها را در دنباله نوکلئوتیدی از دو جهت مخالف می‌خوانیم مکمل یکدیگر هستند، به شکل یک فنر دوتایی جفت شوند (ساقه) به طوری که در انتهایشان یک حلقه جفت نشده دیده شود. این الگوها عموماً بخش کلیدی برای بسیاری از ساختار دوم آر ان ای هستند.

شکل ساختار و استحکام[ویرایش]

شکل یک ساختار حلقه-ساقه‌ای به استحکام آن بر اساس ناحیه مارپیچ (ساقه) و حلقه انتهایی آن وابسته است. اولین پیش نیاز برای این ساختار وجود دنباله‌ای است که بتواند روی خود تا بخورد و فرم یک مارپیچ دوتایی جفت شده را به وجود آورد. استحکام این مارپیچ به کمک طول آن، تعداد بازهای جفت نشده موجود (که تعداد کمی از آنها به خصوص در ساقه‌های بلند قابل قبول هستند) و نوع بازهای موجود در ناحیه جفت شده مشخص می‌گردد. جفت گوانین و سیتوزین سه پیوند هیدروژنی ایجاد می‌کند و بسیار محکم تر از جفت آدنین و اوراسیل با دو پیونn هیدروژنی است. در اسید ریبونوکلئیک (RNA) جفت گوانین و اوراسیل با دو پیوند هیدروژنی نیز مرسوم و مطلوب است.

استحکام حلقه انتهایی نیز در فرم حلقه بنیادی مؤثر است. «حلقه» با تعداد حداقل سه یا جهار باز می‌تواند تشکیل شود و این حلقه‌های کوتاه پایداری زیادی دارند[۱]. حلقه‌های بزرگ که ساختار خاصی ندارند (مانند شبه گره‌ها) نیز پایداری کمتری دارند. یک حلقه بهینه از ۴ الی ۸ باز تشکیل شده استCitation needed. حلقه های با نام حلقه تترا (tetraloop) شناخته می‌شود که با توجه به اثر متقابل بازهای موجود خود به طور خاص پایدار است[۲].

محتوای ساختاری[ویرایش]

ساختار حلقه-ساقه در mRNA و به خصوص در tRNA، که شامل سه حلقه بنیادی و یک دنباله است و فرم برگ شبدری دارد، رخ می‌دهد. یک آنتی کدون که کدون‌ها (codon) را در طول فرایند ترجمه تشخیص می‌دهد در یکی از حلقه‌های جفت نشده tRNA وجود دارد. در شبه گره موجود در آر ان ای دو حلقه-ساقه وجود دارد که حلقه یکی از آنها بخشی از دیگری را تشکیل می‌دهد.

بسیاری از ریبوزوم‌ها از ساختارهای حلقه‌-ساقه‌ای تشکیل شده‌اند. ریبوزوم سرچکشی (hammerhead ribozyme) نیز از سه حلقه-ساقه تشکیل شده است که در یک حلقه مرکزی جفت نشده به یکدیگر متصل می‌شوند.

ساختار حلقه-ساقه‌ای در mRNA در سایت اتصال ریبوزوم (ribosome binding site) رخ می‌دهد و آغاز ترجمه (translation)را کنترل می‌کند.[۳][۴]

مثال[ویرایش]

---CCTGCXXXXXXXGCAGG--- که می‌تواند شکل زیر را به خود بگیرد:

---C G---
 C G
 T A
 G C
 C G
 X X
 X X
 X X
 X

مثال طولانی‌تر دیگری که می‌تواند فرم حلقه-ساقه‌ای را به خود بگیرد در زیر آمده است:

GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC[ویرایش]

منابع[ویرایش]

  1. Santini, Guillaume P. H.; Pakleza, Christophe; Cognet, Jean A. H. (2003-02-01). "DNA tri‐ and tetra‐loops and RNA tetra‐loops hairpins fold as elastic biopolymer chains in agreement with PDB coordinates". Nucleic Acids Research. 31 (3): 1086–1096. doi:10.1093/nar/gkg196. ISSN 0305-1048.
  2. Nayak, Rajesh K.; Van Orden, Alan (2013-11-05). "Counterion and Polythymidine Loop-Length-Dependent Folding and Thermodynamic Stability of DNA Hairpins Reveal the Unusual Counterion-Dependent Stability of Tetraloop Hairpins". The Journal of Physical Chemistry B. 117 (45): 13956–13966. doi:10.1021/jp404832d. ISSN 1520-6106.
  3. Malys N, Nivinskas R (2009). "Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction". Mol Microbiol. 73 (6): 1115–1127. doi:10.1111/j.1365-2958.2009.06840.x. PMID 19708923.
  4. Malys N, McCarthy JEG (2010). "Translation initiation: variations in the mechanism can be anticipated". Cellular and Molecular Life Sciences. 68 (6): 991–1003. doi:10.1007/s00018-010-0588-z. PMID 21076851.
  • Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R. (2004). Molecular Biology of the Gene. 5th ed. Pearson Benjamin Cummings: CSHL Press. See esp. ch. 6.