حلقه‌های بنیادی

از ویکی‌پدیا، دانشنامهٔ آزاد
پرش به: ناوبری، جستجو
یک مثال از حلقه بنیادی در آران ای

حلقه های بنیادی یا stem-loopالگویی است که می تواند در دی ان ای تک رشته ای و البته بیشتر در آر ان ای رخ دهد. این ساختار را به عنوان سنجاق سر (hairpin) یا حلقه سنجاق سری (hairpin-loop) نیز معرفی می شود. ساختار ذکرشده زمانی به وجود می آید که دو ناحیه از یک رشته، که معمولاً وقتی آنها را در دنباله نوکلئوتیدی از دو جهت مخالف می خوانیم مکمل یکدیگر هستند، به شکل یک فنر دوتایی جفت شوند به طوری که در انتهایشان یک حلقه جفت نشده دیده شود. این الگوها عموماً بخش کلیدی برای بسیاری از ساختار دوم آر ان ای هستند.

شکل ساختار و استحکام[ویرایش]

شکل یک حلقه بنیادی به استحکام آن بر اساس ناحیه مارپیچ و حلقه انتهایی آن وابسته است. اولین پیش نیاز برای این ساختار وجود دنباله ای است که بتواند روی خود تا بخورد و فرم یک مارپیچ دوتایی جفت شده را به وجود آورد. استحکام این مارپیچ به کمک طول آن، تعداد بازهای جفت نشده موجود(که تعداد کمی از آنها به خصوص در مارپیچ های بلند قابل قبول هستند.) و نوع بازهای موجود در ناحیه جفت شده مشخص می گردد. جفت گوانین و سیتوزین سه پیوند هیدروژنی ایجاد می کند و بسیار محکم تر از جفت آدنین و اوراسیل با دو پیونn هیدروژنی است. در اسید ریبونوکلئیک (RNA) جفت گوانین و اوراسیل با دو پیوند هیدروژنی نیز مرسوم و مطلوب است. اثر متقابل بازهای جفت شده، که اوربیتال پی را در جهت مطلوب همتراز می کنند، فرم مارپیچ ا به وجود می آورند.

استحکام حلقه انتهایی نیز در فرم حلقه بنیادی موثر است. "حلقه" با کمتر از چهار باز تشکیل نمی‌شود. حلقه های بزرگ که ساختار خاصی ندارند (مانند شبه گره ها) نیز پایدار نیستند. یک حلقه بهینه از ۴ الی ۸ باز تشکیل شده است. حلقه رایج با دنباله UUCG با نام حلقه تترا (tetraloop) شناخته می شود که با توجه به اثر متقابل بازهای موجود خود به طور خاص پایدار است.

محتوای ساختاری[ویرایش]

حلقه های بنیادی در mRNA و به خصوص در tRNA، که شامل سه حلقه بنیادی و یک دنباله است و فرم برگ شبدری دارد، رخ می دهد. یک آنتی کدون که کدون ها (codon) را در طول فرایند ترجمه تشخیص می دهد در یکی از حلقه های جفت نشده tRNA وجود دارد. در شبه گره موجود در آر ان ای دو حلقه بنیادی وجود دارد که حلقه یکی از آنها بخشی از دیگری را تشکیل می دهد.

بسیاری از ریبوزوم ها از حلقه های بنیادی تشکیل شده اند. ریبوزوم سرچکشی (hammerhead ribozyme) نیز از سه حلقه بنیادی تشکیل شده است که در یک حلقه مرکزی جفت نشده به یکدیگر متصل می شوند.

ساختار حلقه بنیادی در mRNA در سایت اتصال ریبوزوم ( ribosome binding site) رخ می دهد و آغاز ترجمه (translation)را کنترل می کند.[۱][۲]

مثال[ویرایش]

---CCTGCXXXXXXXGCAGG--- که می تواند شکل زیر را به خود بگیرد:

---C G---
   C G
   T A
   G C
   C G
   X X
  X   X
   X X
    X

مثال طولانی تر دیگری که می تواند فرم حلقه بنیادی را به خود بگیرد در زیر آمده است:

GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC[ویرایش]

منابع[ویرایش]

  1. Malys N, Nivinskas R (2009). "Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction". Mol Microbiol 73 (6): 1115–1127. DOI:10.1111/j.1365-2958.2009.06840.x. PMID 19708923. 
  2. Malys N, McCarthy JEG (2010). "Translation initiation: variations in the mechanism can be anticipated". Cellular and Molecular Life Sciences 68 (6): 991–1003. DOI:10.1007/s00018-010-0588-z. PMID 21076851. 
  • Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R. (2004). Molecular Biology of the Gene. 5th ed. Pearson Benjamin Cummings: CSHL Press. See esp. ch. 6.